1. Specifications of nGS FusionPrimers:
Amplicon Fusion Primers have to consist of a directional 5´ GS FLX Titanium Primer A or Primer B sequence portion followed by the 4 base library “key” (TCAG) and a template-specific sequence at the 3’ prime end. Optionally, a Multiplex Identifier (MID) sequence (10mer) may be interposed between the “key” and the template-specific sequence to allow for automated identification of pooled samples through “bar-coded” multiplex sequencing, and thus for throughput maximization from a single sequencing run.
Figure 1: Concept of 454™ nGS FusionPrimers
Forward
primer (Primer A-Key):
5’ - CGTATCGCCTCCCTCGCGCCATCAG - {MID} - {template-specific-sequence} - 3‘
Reverse
primer (Primer B-Key):
5’ - CTATGCGCCTTGCCAGCCCGCTCAG - {MID} - {template-specific-sequence} - 3’
Consequently, the length of an
- Amplicon Fusion Primer without MID ranges between 45-50 nts
and refers to metabion´s nGS FusionPrimers (-)MID
- Amplicon Fusion Primer with MID ranges between 55-60 nts
and refers to metabion´s nGS FusionPrimers (+)MID.
Table 1: metabion Custom Amplicon Fusion Primer portfolio and pricing
| primer category |
nGS FusionPrimers (-)MID |
nGS FusionPrimers (+)MID |
| primer description |
45-50mers**; unmodified
|
55-60mers**; unmodified
|
Scales
Yield range in nmol |
Price (€)* |
Price (€)* |
| >/= 5 <10 |
25.00 |
35.00 |
| >/=10 <20 |
30.00 |
40.00 |
| >/=20 <30 |
40.00 |
50.00 |
| >/=30 <50 |
60.00 |
70.00 |
| >/=50 <70 |
80.00 |
100.00 |
| >/=70 |
please inquire |
please inquire |
* All prices in EUR excluding tax and transport.
** nGS FusionPrimers exceeding the respectively indicated maximum length will incur an additional charge of 4 EURO per base.
2. Specifications of nGS Adaptors:
454™nGS Adaptors are used for preparation of a “General” library from fragmented DNA samples (i. e. genomic DNA from a target organism, BACs, YACs, cosmids, etc.) to be decoded by shotgun sequencing. In this context, a “General” library means a library other than a “Paired End” or an “Amplicon” library. It consists of a random set of ss DNA fragments representing the entire target sequence. Each fragment is flanked by suitable amplification and sequencing DNA Adaptors (nGS Adaptors). It´s obligatory to purify and quantify the library prior to further processing.
Following fragmentation, purification and polishing of the DNA library, oligonucleotide sequences termed “Adaptors”, i. e. nGS Adaptor A-s (-)MID, nGS Adaptor A-l (-)MID, nGS Adaptor A-s (+)MID, nGS Adaptor A-l (+)MID, nGS Adaptor B-s, nGS Adaptor B-l (see table 2 below) are first annealed to form pairs of ds-oligonucleotides (Adaptors “A” and “B”) and then ligated to the ends of each sample DNA fragment in order to provide priming regions for amplification and nucleotide sequencing. Adaptors design allows directional ligation to the polished dsDNA library fragments.
454™Adaptor characteristics are
- a 5’-overhang at the amplification and sequencing priming end
- a blunt-ended 3’ key region with or without a 10 nt sequence tag (+/- MID) on Adaptor A
- a unique 4 nt non-palindromic sequencing key for Adaptor A
- a 5´ Biotin-TEG label on the Adaptor B-l (long) oligo.
- 4 PTO modifications on both ends of the oligomers.
Figure 2: Examples of annealed Adaptors A with and without (+/-)MID
a) (+)MID
to be ordered by using our 454™nGS oligo order form (download)
| 454™nGS oligo type |
oligo name |
sequence 5´-3´ |
| nGS Adaptor A-l (+)MID |
Oligo a |
CCATCTCATCCCTGCGTGTCTCCGACTCAGCATAGTAGTG |
| nGS Adaptor A-s (+)MID |
Oligo b |
CACTACTATGCTGAGTCGGAGA |
By selecting 454™nGS oligo type, respective mandatory modifications are specified. Consequently, both oligos will be synthesized with a PTO-4 cap on both ends (no * indices needed for your convenience).
Please observe 5´-3´orientation of the short Adaptor (A-s) sequence (Oligo b).
b) (-)MID
to be ordered by using our 454™nGS oligo order form (download)
| 454™nGS oligo type |
oligo name |
sequence 5´-3´ |
| nGS Adaptor A-l (-)MID |
Oligo c |
CCATCTCATCCCTGCGTGTCTCCGACTCAG |
| nGS Adaptor A-s (-)MID |
Oligo d |
CTGAGTCGGAGA |
By selecting 454™nGS oligo type, respective mandatory modifications are specified. Consequently, both oligos will be synthesized with a PTO-4 cap on both ends (no * indices needed for your convenience).
Please observe 5´-3´orientation of the short Adaptor (A-s) sequence (Oligo d).
Figure 3: Example of annealed Adaptor B
to be ordered by using our 454™nGS oligo order form (download)
| 454™nGS oligo type |
oligo name |
sequence 5´-3´ |
| nGS Adaptor B-l |
Oligo e |
CCATCTCATCCCTGCGTGTCTCCGACTCAG |
| nGS Adaptor B-l |
Oligo f |
CTGAGTCGGAGA |
By selecting 454™nGS oligo type, respective mandatory modifications are specified. Consequently, both oligos will be synthesized with a PTO-4 cap on both ends (no * indices needed for your convenience) and the Adaptor B-l (long) sequence will carry a 5´Biotin-TEG label.
Please observe 5´-3´orientation of the short Adaptor (B-s) sequence (Oligo f).
Table 2: metabion Custom 454™Adaptor oligo portfolio and pricing
| adaptor category |
nGS Adaptor A(-)MID |
nGS Adaptor A(+)MID |
nGS Adaptor B |
| primer category |
nGS Adaptor A-s(-)MID |
nGS Adaptor A-I(-)MID |
nGS Adaptor A-s(+)MID |
nGS Adaptor A-I(+)MID |
nGS Adaptor B-s |
nGS Adaptor B-I |
| primer description |
12mer;
4PTO bonds ends |
30mer;
4PTO bonds ends |
22mer;
4PTO bonds ends |
40mer;
4PTO bonds ends |
12mer;
4PTO bonds ends |
30mer;
4PTO bonds ends; 5'Biotin-TEG |
| |
Price (€)* |
Price (€)* |
Price (€)* |
| |
12mer |
30mer |
22mer |
40mer |
12mer |
30mer |
Scales
Yield range in nmol |
|
|
|
|
|
|
| >/= 5 <10 |
n. a. |
n. a. |
n. a. |
n. a. |
n. a. |
n. a. |
| >/=10 <20 |
n. a. |
n. a. |
n. a. |
n. a. |
n. a. |
n. a. |
| >/=20 <30 |
30.00 |
50.00 |
40.00 |
60.00 |
30.00 |
180.00 |
| >/=30 <50 |
50.00 |
70.00 |
60.00 |
90.00 |
50.00 |
200.00 |
| >/=50 <70 |
70.00 |
90.00 |
80.00 |
100.00 |
70.00 |
220.00 |
| >/=70 |
please inquire |
please inquire |
please inquire |
please inquire |
please inquire |
please inquire |
* All prices in EUR excluding tax and transport.
How to order
For your convenience, please
- download our 454™nGS oligo order form,
- specify desired oligos through the selection criteria/categories provided in the pre-formatted nGS oligo order form,
- attach the created file to an email,
- and send it to oligo@mymetabion.com.
Please make sure to indicate all relevant information in the covering letter of your email such as
- shipping address & contact information (person, phone, fax, email)
- billing address & contact information (person/customer ID, phone, fax, email, VAT #)
- quotation and/or PO # if any. For any questions please contact our customer service team by
Email: info@mymetabion.com
Tel.: +49 (0)89 899 363 0
Fax: +49 (0)89 899 363 11.
