Sanger Sequencing Primer

Sanger sequencing relies on a technique known as capillary electrophoresis, which separates fragments of DNA by size and then sequences them by detecting the final fluorescent base on each fragment. Compared to the more recently developed NGS technologies, Sanger sequencing is slow and expensive, but it is highly accurate, which is one of the reasons why it still remains a valuable tool.

To date, Sanger sequencing is still widely used for small-scale experiments and for "finishing" regions that cannot be easily sequenced by NGS platforms (e.g. highly repetitive DNA).

The issue is read length. Read length is absolutely crucial when it comes to accurate sequence assembly, especially for complex and repetitive genomes. If a repetitive region is much longer than the reading capacity of a platform, gathering decoded fragments unambiguously is not feasible. Thus, genomes sequenced on current nGS platforms actually consist of hundreds of thousands of correctly sequenced fragments interspersed by gaps. That’s good enough for most purposes, but it’s by no means a complete genome sequence. Hence, Sanger sequencing is still indispensable, when it comes to producing complete/gapless genomic sequence data.

metabion now offers an extensive list of high performance best-value Sanger sequencing standard primers. Our conveniently packaged mi-mos sequencing primers are ready-to-use for GATC LIGHTrun sequencing services or equivalent/similar Sanger Sequencing approaches.

Our service at a glance:

  • Primers provided in 5µM aqueous solution containing 2 nmol of highly pure primer in 400µl H2O
  • Great convenience package, sufficient for approx. 80 high performance sequencing rxns, at a best-value price of EURO 3.50 each (excluding taxes and transport).
  • QCed by Maldi-ToF
  • ready-to-use for GATC LIGHTrun sequencing services or equivalent/similar Sanger Sequencing approaches
  • at a speedy turnaround: orders submitted till 15:00 CET (Monday till Friday) will be shipped the same day, and arrive at your end according to geographic delivery terms (Subject to in-stock availability).
ProductCat. No.Sequence  (5´-3´)
16S-1392r mi-mos1001 ACGGGCGGTGTGTRC
16S-27f mi-mos1002 AGAGTTTGATCMTGGCTCAG
3'-Gal 4 mi-mos1003 GAACTTGCGGGGTTTTTC
35S-A mi-mos1004 AAGGGTCTTGCGAAGGATAG
35S-B mi-mos1005 AGTGGAAAAGGAAGGTGGCT
BAC1 mi-mos1006 GCTCGTATGTTGTGTGGAATTG
BAC2 mi-mos1007 CCCAGTCACGACGTTGTAAAAC
BGH-Reverse mi-mos1008 TAGAAGGCACAGTCGAGG
CMV-F mi-mos1009 CGCAAATGGGCGGTAGGCGTG
EBV-RP mi-mos1010 GTGGTTTGTCCAAACTCATC
EGF1 mi-mos1011 CCAAGCTATTTAGGTGACAC
EGF2 mi-mos1012 GGGGATGTGCTGCAAGG
GFPN1-5 mi-mos1013 GAGCTCAAGCTTCGAATTC
GLprimer1 mi-mos1014 TGTATCTTATGGTACTGTAACTG
KAN2-FP mi-mos1015 ACCTACAACAAAGCTCTCATCAACC
KAN2-RP mi-mos1016 GCAATGTAACATCAGAGATTTTGAG
KS mi-mos1017 TCGAGGTCGACGGTATC
LPP1 mi-mos1018 ATACGACTCACTATAGGGAGAC
LPP2 mi-mos1019 ACAAATTGGACTAATCGATGGC
M13-FP mi-mos1020 TGTAAAACGACGGCCAGT
M13-RP mi-mos1021 CAGGAAACAGCTATGACC
pACT2-FP mi-mos1022 GATGATGAAGATACCCCAC
pACT2-RP mi-mos1023 CAGTTGAAGTGAACTTGC
pBacPAC-RP mi-mos1024 GTCTGTAAATCAACAACGC
pBAD-FP mi-mos1025 ATGCCATAGCATTTTTATCC
pBakPAC-FP mi-mos1026 TAAAATGATAACCATCTCGC
pBR1 mi-mos1027 CGAAAAGTGCCACCTGAC
pBR2 mi-mos1028 GGAGCCACTATCGACTAC
pBR3 mi-mos1029 TCCCCATCGGTGATGTC
PBR4 mi-mos1030 CTCGGCACCGTCACC
pc3.1GFP-Topo-RP mi-mos1031 CCCATTAACATCACC
pcDNA1.1-RP mi-mos1032 CTCTGTAGGTAGTTTGTCC
pcDNA1.1-RP/1 mi-mos1033 TAGAATCAGTAGTTTAACAC
pcDNA3.1-FP mi-mos1034 CTCTGGCTAACTAGAGAAC
pcDNA3.1-RP/1 mi-mos1035 CAAACAACAGATGGCTGGC
PCR1 mi-mos1036 CGGGCCTCTTCGCTATT
PCR1minus1 mi-mos1037 GGGCCTCTTCGCTATT
PCR2 mi-mos1038 TTAGCTCACTCATTAGG
pDONOR-FP mi-mos1039 TAACGCTAGCATGGATCTC
pDONOR-RP mi-mos1040 GCAATGTAACATCAGAGAT
pEGFP-FP mi-mos1041 TTTAGTGAACCGTCAGATC
pEGFP-N mi-mos1042 CCGTCCAGCTCGACCAG
pEGFP-RP mi-mos1043 AACAGCTCCTCGCCCTTG
pEGFP_C2-FP mi-mos1044 GATCACATGGTCCTGCTG
pEGFP_C2-RP mi-mos1045 TTTAAAGCAAGTAAAACCTC
pESP-RP mi-mos1046 TCCAAAAGAAGTCGAGTGG
pET-24a mi-mos1047 GGGTTATGCTAGTTATTGCTCAG
pET-RP mi-mos1048 CTAGTTATTGCTCAGCGG
pET30er-FP mi-mos1049 TCATCATTCTTCTGGTCTG
pET36b-FP mi-mos1050 GCTAAATTCGAACGCCAG
pETBlue-RP mi-mos1051 AATAGCTTTAATGCGGTAG
pGBT9-FP mi-mos1052 AGTGCGACATCATCATCG
pGBT9-RP mi-mos1053 CGTTTTAAAACCTAAGAGTCAC
pGEX-3 mi-mos1054 GGAGCTGCATGTGTCAGAG
pGEX-5 mi-mos1055 CTGGCAAGCCACGTTTGG
pGEX3-RP mi-mos1056 TCAAGAATTATACACTCCG
pGEX5-FP mi-mos1057 AACGTATTGAAGCTATCCC
pGFP-FP mi-mos1058 GAGTTTGTAACAGCTGCTG
pGL2 mi-mos1059 TCTTTATGTTTTTGGCGTC
pGL3-1 mi-mos1060 GAGCTGACTGGGTTGAAG
pGL3-RV3 mi-mos1061 CTAGCAAAATAGGCTGTCC
pIRES-RP mi-mos1062 TATAGACAAACGCACACCG
pJet1-FP mi-mos1063 ACTACTCGATGAGTTTTCGG
pJet1-RP mi-mos1064 TGAGGTGGTTAGCATAGTTC
pMalE mi-mos1065 TCAGACTGTCGATGAAGC
pMT-FP mi-mos1066 CATCTCAGTGCAACTAAAG
PolyA-B mi-mos1067 AAAAAAAAAAAAAAAAAAAAAAAB
PolyC-D mi-mos1068 CCCCCCCCCCCCD
PolyT-V mi-mos1069 TTTTTTTTTTTTTTTTTTTTTTTV
pQE-FP mi-mos1070 CGGATAACAATTTCACACAG
pQE-RP mi-mos1071 GTTCTGAGGTCATTACTGG
pREP-FP mi-mos1072 GCTCGATACAATAAACGCC
pRH-FP mi-mos1073 CTGTCTCTATACTCCCCTATAG
pRH-RP mi-mos1074 CAAAATTCAATAGTTACTATCGC
pRSET-RP mi-mos1075 ATGCTAGTTATTGCTCAGC
pRSET-RPnew mi-mos1076 GGGTTATGCTAGTTATTGC
pTal-FP mi-mos1077 CGGGAGGTACTTGGAGCG
pTeSp-1 mi-mos1078 CCTCCATAGAAGACACC
pTeSp-2 mi-mos1079 GCCCTGCCACTCATCG
pTI2-1-1 mi-mos1080 GGCAAATATTCTGAAATGAGC
pTI2-1-2 mi-mos1081 GCGTTTCACTTCTGAGTTCG
pTrcHis-FP mi-mos1082 GACCGGAATTATCGATTAAC
pTrcHis-RP mi-mos1083 CTGATTTAATCTGTATCAGG
pTYB-FP mi-mos1084 GGAAGACGATTATTATGGG
pUC-F mi-mos1085 GCCAGTGAATTCGAGCTCGG
pUC-R mi-mos1086 TGCCTGCAGGTCGACTCTAG
pVL1 mi-mos1087 GGGTTTAACATTACGGATTTC
pVL2 mi-mos1088 GACGCACAAACTAATATCAC
pVP22-FP mi-mos1089 CGCTTCTCGCCCCAGAC
RPC mi-mos1090 ACAGCTATGACCATGATTACG
SK mi-mos1091 CGCTCTAGAACTAGTGGATC
SP6 mi-mos1092 ATTTAGGTGACACTATAGAA
T3 mi-mos1093 ATTAACCCTCACTAAAGGGA
T7 mi-mos1094 TAATACGACTCACTATAGGG
T7-981079 mi-mos1095 TAATACGACTCACTATAG
T7minus1 mi-mos1096 AATACGACTCACTATAGGG
TET-1 FP-1 mi-mos1097 GGGTGCGCATGATCCTCTAGAGT
TET-1 RP-1 mi-mos1098 TAAATTGCACTGAAATCTAGAAATA
Topo-1 mi-mos1099 TCGGATCCACTAGTAACG
Topo-2 mi-mos1100 GTGTGATGGATATCTGC
Topo-2N mi-mos1101 AGATGCATGCTCGAGCGG
TriplEx5`LD mi-mos1102 GAAGCGCGCCATTGTGTTGG
UP-2 mi-mos1103 CGTTGTAAAACGACGGCC
UP-40 mi-mos1104 GTTTTCCCAGTCACGAC
ProductDatasheet
16S-1392r mi-mos1001
16S-27f mi-mos1002
3'-Gal 4 mi-mos1003
35S-A mi-mos1004
35S-B mi-mos1005
BAC1 mi-mos1006
BAC2 mi-mos1007
BGH-Reverse mi-mos1008
CMV-F mi-mos1009
EBV-RP mi-mos1010
EGF1 mi-mos1011
EGF2 mi-mos1012
GFPN1-5 mi-mos1013
GLprimer1 mi-mos1014
KAN2-FP mi-mos1015
KAN2-RP mi-mos1016
KS mi-mos1017
LPP1 mi-mos1018
LPP2 mi-mos1019
M13-FP mi-mos1020
M13-RP mi-mos1021
pACT2-FP mi-mos1022
pACT2-RP mi-mos1023
pBacPAC-RP mi-mos1024
pBAD-FP mi-mos1025
pBakPAC-FP mi-mos1026
pBR1 mi-mos1027
pBR2 mi-mos1028
pBR3 mi-mos1029
PBR4 mi-mos1030
pc3.1GFP-Topo-RP mi-mos1031
pcDNA1.1-RP mi-mos1032
pcDNA1.1-RP/1 mi-mos1033
pcDNA3.1-FP mi-mos1034
pcDNA3.1-RP/1 mi-mos1035
PCR1 mi-mos1036
PCR1minus1 mi-mos1037
PCR2 mi-mos1038
pDONOR-FP mi-mos1039
pDONOR-RP mi-mos1040
pEGFP-FP mi-mos1041
pEGFP-N mi-mos1042
pEGFP-RP mi-mos1043
pEGFP_C2-FP mi-mos1044
pEGFP_C2-RP mi-mos1045
pESP-RP mi-mos1046
pET-24a mi-mos1047
pET-RP mi-mos1048
pET30er-FP mi-mos1049
pET36b-FP mi-mos1050
pETBlue-RP mi-mos1051
pGBT9-FP mi-mos1052
pGBT9-RP mi-mos1053
pGEX-3 mi-mos1054
pGEX-5 mi-mos1055
pGEX3-RP mi-mos1056
pGEX5-FP mi-mos1057
pGFP-FP mi-mos1058
pGL2 mi-mos1059
pGL3-1 mi-mos1060
pGL3-RV3 mi-mos1061
pIRES-RP mi-mos1062
pJet1-FP mi-mos1063
pJet1-RP mi-mos1064
pMalE mi-mos1065
pMT-FP mi-mos1066
PolyA-B mi-mos1067
PolyC-D mi-mos1068
PolyT-V mi-mos1069
pQE-FP mi-mos1070
pQE-RP mi-mos1071
pREP-FP mi-mos1072
pRH-FP mi-mos1073
pRH-RP mi-mos1074
pRSET-RP mi-mos1075
pRSET-RPnew mi-mos1076
pTal-FP mi-mos1077
pTeSp-1 mi-mos1078
pTeSp-2 mi-mos1079
pTI2-1-1 mi-mos1080
pTI2-1-2 mi-mos1081
pTrcHis-FP mi-mos1082
pTrcHis-RP mi-mos1083
pTYB-FP mi-mos1084
pUC-F mi-mos1085
pUC-R mi-mos1086
pVL1 mi-mos1087
pVL2 mi-mos1088
pVP22-FP mi-mos1089
RPC mi-mos1090
SK mi-mos1091
SP6 mi-mos1092
T3 mi-mos1093
T7 mi-mos1094
T7-981079 mi-mos1095
T7minus1 mi-mos1096
TET-1 FP-1 mi-mos1097
TET-1 RP-1 mi-mos1098
Topo-1 mi-mos1099
Topo-2 mi-mos1100
Topo-2N mi-mos1101
TriplEx5`LD mi-mos1102
UP-2 mi-mos1103
UP-40 mi-mos1104

How to order

Online

Preferred ordering mode is using our web order portal for most convenient web shopping!

Email

send an email to mi@mymetabion.com, include your customer id (if you have one).
If you are a new customer, please additionally provide us with

  • Your shipping and billing address
  • Any other information like Purchase Order number, VAT number (VAT only for customers resident in the EU) etc
  • and any special shipping requests.

Confirmation

Orders which indicate an email address will be confirmed by email.

Delivery

Our default shipping mode is sending by Express service overnight at EURO 4,20 per shipment within Germany. If the value of your order is > EURO 125,00, shipping within Germany is free of charge!

For other countries please see our shipping table.

Note that Shipments on blue ice incur an additional charge of 4.50 EUR.
Shipments on dry ice incur an additional charge of 9.50 EUR.

Sanger sequencing primers will be shipped as soon as possible after receiving your confirmed order. If you want to combine shipments of different product categories/orders for cost saving reasons, please indicate.

Transportation damages have to be immediately/ upon receipt of goods notified to the parcel service!

All our products are offered according to our terms & conditions. For in vitro use and research purposes only!